Analysis of the testimonial evidence of Portugal's first major forensic case: part II

Analysis of the testimonial evidence of Portugal’s first major forensic case: part II

Antibodies, Assay Kits, Biology Cells, Bioremediation of Contaminated Lake Sediments and Evaluation of Maturity Indicies as Indicators of Compost Stability, Cation Exchange Capacity & Sorption Capacity Index, cDNA, Clia Kits, Comparison of αβδ and αβγ GABAA receptors: Allosteric modulation and identification of subunit arrangement by site-selective general anesthetics., Crystal structure of an acetyltransferase protein from Vibrio cholerae strain N16961, DNA Testing, Elisa Kits, Enzymes, Equipments, Exosomes, Expression, purification and preliminary X-ray diffraction analysis of the catalytic module of a beta-agarase from the flavobacterium Zobellia galactanivorans, Gels, High-level production and purification in a functional state of an extrasynaptic gamma-aminobutyric acid type A receptor containing α4β3δ subunits., In vitro models for oral malodor, Kinetic and structural studies of aldehyde oxidoreductase from Desulfovibrio gigas reveal a dithiolene-based chemistry for enzyme activation and inhibition by H(2)O(2)., Medium & Serums, My Blog, On the Chameleonic Behaviour of Cholesterol through a Fractal/Multifractal Model., Particles, Pcr Kits, Structure and activity of Paenibacillus polymyxa xyloglucanase from glycoside hydrolase family 44 / By

The crime probably perpetrated by a physician named Vicente Urbino de Freitas in 1890 is one of the most well-known circumstances of poisoning, and it had echoes in the Portuguese and overseas press for a number of many years. This prestigious physician was convicted of the deadly poisoning of his nephew. He additionally tried the murder of two nieces and their mother-in-law, who solely escaped as a result of they obstinately refused to adjust to the “therapeutics” prescribed by the household physician.

The motive of the crime ought to have been Vicente Urbino de Freitas’ ambition to obtain the household inheritance of his spouse, the daughter of the well-known service provider José António Sampaio of Flores Street in Porto. Vicente Urbino de Freitas was convicted however doubt about his guilt persists for greater than a century. This second work aimed to gather and analyse all the related and contradictory testimonial evidence of the prosecution and defence witnesses. This case represents an odd historic file obtained by greater than 12 years of analysis on the first major vital Portuguese forensic case. Rare and unprecedented testimonial evidence and images had been obtained from totally different international locations after which repaired, since these additionally present an essential historic file of the medical pictures.

A survey instrument utilizing a Likert scale to point settlement or disagreement with 21 questions was developed utilizing qualitative interviews earlier than being distributed on-line inside Australia. Sampling of contributors was stratified by age, gender and site. The outcomes had been subjected to statistical evaluation with Spearman Rank Correlation check getting used for bivariate evaluation. One thousand 5 hundred sixty-four full surveys had been collected. The outcomes revealed sure client beliefs, for instance; the title of ‘Dr’ was believed to point ability and excessive ranges of coaching (81.0%), with 80.3% agreeing incorrectly that use of the title was strictly regulated.
Participants reported to have a better confidence in their very own skills (71.2%) than the public (52.8%) in assessing well being promoting. The degree of self-confidence elevated with larger training degree and decreased by age (p < 0.05). Testimonials had been reported to be missing in reliability (67.7%) and that they shouldn’t be utilized in healthcare in the identical method as they’re utilized in different industries. Only 44.8% of contributors reported that they felt assured to identify a evaluate that was not written by a real consumer of a service.

#BeTheMatch: Assessing How Testimonials on Reddit Promote the Importance of Donating Bone Marrow

 

This examine explores how sharing testimonials on the social media community Reddit could encourage people to donate bone marrow. The idea of deliberate habits guided a quantitative content material evaluation of 1,015 Reddit feedback about donation. Research questions requested how people submit about donation and the way Redditors have interaction with this content material. Overall, feedback addressed extra constructive than unfavorable final result, efficacy, and normative beliefs. Comments that mentioned beliefs associated to registering to donate and the course of of donating acquired considerably larger engagement than different feedback.

Additionally, feedback that included constructive final result beliefs associated to registering, constructive efficacy beliefs associated to registering and donating, and constructive normative beliefs associated to donating acquired larger engagement than different feedback. Results recommend testimonials could also be best in the event that they give attention to habits facilitators and in the event that they current donation as a constructive norm deviant habits. Finally, the Reddit boards functioned as locations for people to hunt out and share data. Comments included calls to motion and hyperlinks for well being sources. This analysis reveals how natural conversations on Reddit could promote well being data looking for and advocacy habits adoption. Implications for the idea of deliberate habits and the use of Reddit as a platform for well being promotion are mentioned.

Analysis of the testimonial evidence of Portugal's first major forensic case: part II

Narrative Voice Matters! Improving Smoking Prevention with Testimonial Messages by Identification and Cognitive Processes

 

Narrative messages are more and more being utilized in the subject of tobacco prevention. Our examine relies on narrative persuasion and goals to investigate the psychological mechanisms that specify why the narrative voice is related to advertise persuasive influence. An on-line experiment with a 2 (narrative voice) × 2 (message) factorial design was carried out. Participants (525 grownup people who smoke) had been randomly assigned to 2 experimental situations (first-person versus third-person narrative message). To improve the exterior validity of the examine, two totally different messages had been used inside every situation. After studying the narrative message the mediating and dependent variables had been evaluated.

ASAH2 Rabbit pAb
A12596-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb
A12596-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb
A12596-50ul 50 ul
EUR 223

ASAH2 Rabbit pAb
A7985-100ul 100 ul
EUR 308

ASAH2 Rabbit pAb
A7985-200ul 200 ul
EUR 459

ASAH2 Rabbit pAb
A7985-20ul 20 ul
EUR 183

ASAH2 Rabbit pAb
A7985-50ul 50 ul
EUR 223

ASAH2 Antibody
24731-100ul 100ul
EUR 390

ASAH2 antibody
70R-12124 100 ug
EUR 403
Description: Rabbit polyclonal ASAH2 antibody

ASAH2 Antibody
36240-100ul 100ul
EUR 252

ASAH2 Antibody
3828-100
EUR 316

ASAH2 Antibody
3828-30T
EUR 146

ASAH2 Antibody
1-CSB-PA002170EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:100-1:500, IF:1:50-1:500

ASAH2 Antibody
1-CSB-PA076840
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Antibody
1-CSB-PA133826
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

ASAH2 Polyclonal Antibody, HRP Conjugated
A62107 100 µg
EUR 570.55
Description: reagents widely cited

ASAH2 Polyclonal Antibody, FITC Conjugated
A62108 100 µg
EUR 570.55
Description: Ask the seller for details

ASAH2 Polyclonal Antibody, Biotin Conjugated
A62109 100 µg
EUR 570.55
Description: The best epigenetics products

ASAH2 Conjugated Antibody
C36240 100ul
EUR 397

Anti-ASAH2 antibody
STJ110292 100 µl
EUR 277

Anti-ASAH2 antibody
STJ114470 100 µl
EUR 277

ASAH2 siRNA
20-abx900469
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 siRNA
20-abx908270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASAH2 Antibody, HRP conjugated
1-CSB-PA002170EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ASAH2 Antibody, FITC conjugated
1-CSB-PA002170EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ASAH2 Antibody, Biotin conjugated
1-CSB-PA002170ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASAH2. Recognizes ASAH2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ASAH2 Blocking Peptide
33R-10941 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASAH2 antibody, catalog no. 70R-12124

ASAH2 Blocking Peptide
3828BP-50
EUR 153

ASAH2 cloning plasmid
CSB-CL865115HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2181
  • Sequence: ATGAGTGCCATCACAGTGGCCCTTCTCAGCCTCTTGTTTATCACCAGTGGGACCATTGAAAACCACAAAGATTTAGGAGGCCATTTTTTTTCAACCACCCAAAGCCCTCCAGCCACCCAGGGCTCCACAGCCGCCCAACGCTCCACAGCCACCCAGCATTCCACAGCCACCCAGA
  • Show more
Description: A cloning plasmid for the ASAH2 gene.

Mouse ASAH2 shRNA Plasmid
20-abx974501
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat ASAH2 shRNA Plasmid
20-abx987160
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ASAH2 shRNA Plasmid
20-abx961153
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASAH2 Recombinant Protein (Human)
RP036760 100 ug Ask for price

ASAH2 Recombinant Protein (Mouse)
RP117410 100 ug Ask for price

ASAH2 Recombinant Protein (Rat)
RP191108 100 ug Ask for price

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx007107
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
abx025039-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
abx025039-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214010
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx214011
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx177710
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx173712
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody
20-abx303129
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (HRP)
20-abx303130
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (FITC)
20-abx303131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

N-Acylsphingosine Amidohydrolase 2 (ASAH2) Antibody (Biotin)
20-abx303132
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Asah2 ORF Vector (Rat) (pORF)
ORF063704 1.0 ug DNA
EUR 506

ASAH2 ORF Vector (Human) (pORF)
ORF012254 1.0 ug DNA
EUR 354

Asah2 ORF Vector (Mouse) (pORF)
ORF039138 1.0 ug DNA
EUR 506

ASAH2 ELISA Kit (Human) (OKCD01831)
OKCD01831 96 Wells
EUR 831
Description: Description of target: Hydrolyzes the sphingolipid ceramide into sphingosine and free fatty acid at an optimal pH of 6.5-8.5. Acts as a key regulator of sphingolipid signaling metabolites by generating sphingosine at the cell surface. Acts as a repressor of apoptosis both by reducing C16-ceramide, thereby preventing ceramide-induced apoptosis, and generating sphingosine, a precursor of the antiapoptotic factor sphingosine 1-phosphate. Probably involved in the digestion of dietary sphingolipids in intestine by acting as a key enzyme for the catabolism of dietary sphingolipids and regulating the levels of bioactive sphingolipid metabolites in the intestinal tract.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.31 ng/mL

Asah2 sgRNA CRISPR Lentivector set (Rat)
K7087001 3 x 1.0 ug
EUR 339

ASAH2 sgRNA CRISPR Lentivector set (Human)
K0130501 3 x 1.0 ug
EUR 339

Asah2 sgRNA CRISPR Lentivector set (Mouse)
K3499601 3 x 1.0 ug
EUR 339

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) Protein
20-abx654471
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34287m 96 Tests
EUR 865

Human ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-34330h 96 Tests
EUR 824

Rat ASAH2 (Neutral ceramidase) ELISA Kit (CUSTOM)
ELI-48960r 96 Tests
EUR 886

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7087002 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7087003 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7087004 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0130502 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0130503 1.0 ug DNA
EUR 154

ASAH2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0130504 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3499602 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3499603 1.0 ug DNA
EUR 154

Asah2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3499604 1.0 ug DNA
EUR 154

ASAH2 Protein Vector (Mouse) (pPB-C-His)
PV156550 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPB-N-His)
PV156551 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-HA)
PV156552 500 ng
EUR 1065

ASAH2 Protein Vector (Mouse) (pPM-C-His)
PV156553 500 ng
EUR 1065

ASAH2 Protein Vector (Rat) (pPB-C-His)
PV254814 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPB-N-His)
PV254815 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-HA)
PV254816 500 ng
EUR 1166

ASAH2 Protein Vector (Rat) (pPM-C-His)
PV254817 500 ng
EUR 1166

ASAH2 Protein Vector (Human) (pPB-His-MBP)
PV324138 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-His-GST)
PV324139 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-C-His)
PV049013 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPB-N-His)
PV049014 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPM-C-HA)
PV049015 500 ng
EUR 481

ASAH2 Protein Vector (Human) (pPM-C-His)
PV049016 500 ng
EUR 329

Asah2 3'UTR GFP Stable Cell Line
TU152183 1.0 ml Ask for price

Asah2 3'UTR Luciferase Stable Cell Line
TU102183 1.0 ml Ask for price

Asah2 3'UTR Luciferase Stable Cell Line
TU200951 1.0 ml Ask for price

Asah2 3'UTR GFP Stable Cell Line
TU250951 1.0 ml Ask for price

ASAH2 3'UTR GFP Stable Cell Line
TU051220 1.0 ml
EUR 1521

ASAH2 3'UTR Luciferase Stable Cell Line
TU001220 1.0 ml
EUR 1521

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
20-abx156834
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) CLIA Kit
20-abx494694
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ASAH2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV656977 1.0 ug DNA
EUR 1355

ASAH2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV656981 1.0 ug DNA
EUR 1355

ASAH2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV656982 1.0 ug DNA
EUR 1355

Human N-Acylsphingosine Amidohydrolase 2(ASAH2)ELISA Kit
QY-E04735 96T
EUR 361

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
SEE689Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in serum, plasma, tissue homogenates and other biological fluids.

Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) ELISA Kit
4-SEE689Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as N-Acylsphingosine Amidohydrolase 2 elisa. Alternative names of the recognized antigen: HNAC1
  • non-lysosomal ceramidase
  • Neutral ceramidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human N-Acylsphingosine Amidohydrolase 2 (ASAH2) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

Participants who learn the narrative in the first individual skilled larger identification. Moreover, mediational evaluation confirmed that each counterarguing and cognitive elaboration performed a big position in the relationship between narrative voice, identification, and persuasive influence. This examine verify that narrative voice just isn’t solely an anecdotal formal selection however that it not directly impacts variables associated to tobacco prevention, on account of the incontrovertible fact that first-person messages activate a mechanism of affective reference to the message (rising the identification with the protagonist) that decreases resistance to prevention (the counterarguing course of) whereas concurrently stimulating reflection or cognitive elaboration.